Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST66713
Clone ID OST66713
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST66713
Sequence
GCCCGGTCCTGAGTGAAGCCAGGAGAGACAGTACTAGCAGCCTGCAACGCAAGAAACCCCCATGGCTCAAGTTGGACATC
CCAGCCGCGGTGCCCCCGGCAGCAGAGGAGCCCAGCTTCCTGCAGCCCCTGCGGCGACAGGCTTTCTTGCGGAGTGTGAG
TATGCCAGCTGANACAGCCCGGGTCCCATNACCCCACCATGAGCCTCGCCCGGCTGG
Sequence Type mRNA
Unitrap ID UNI27213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32115974..32116268 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020282 (Rhbdf1) NM_010117 rhomboid family 1 (Drosophila) Gene [Source:MGI (curated);Acc:Rhbdf1-006]

 
Come back to gene ENSMUSG00000020282


For any suggestions or comments, please send an email to unitrap@crg.es