Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0443
Clone ID BC0443
Vector pGT2lxr
Project sanger

Sequence tag BC0443
Sequence
CTGTCGTTCACCTCATCCCTCTTCTTCTTCTTCTCAATCTGTGCTTATTCTCTTTTTTTCTCTTCATACTCTTTTTTCCA
TTTCTTGCTCCGTTTCTTCTCCTTCCTCGACCGATCCTTCTTCCTCTTATACTTTATATTTCTCTGTTTTTGCATTCTTT
CTCTCCTTGTTCTTCTCCGTCCCGCCGTCCCTCCCCGTCCAGCTCGGGCCGCCGGGCTCCCGCAGGCCCCACCGCCCGCG
TTCCTATGGACAGACGCACAGACACCTGCAG
Sequence Type mRNA
Unitrap ID UNI906

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59639267..59639363 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045071 (E130308A19Rik) NM_153158 RIKEN cDNA E130308A19 gene Gene [Source:MGI Symbol;Acc:MGI:2442164]

 
Come back to gene ENSMUSG00000045071


For any suggestions or comments, please send an email to unitrap@crg.es