Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST66575
Clone ID OST66575
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST66575
Sequence
AATGACCCCTAGAGTAAAACCTGCTTCCCAGTCGGAGATCTCATCATTCTTTCCTGGCCCAGATGTGACACCTGCTCATC
CATTTTCTGACGAGGAAAG
Sequence Type mRNA
Unitrap ID UNI27216

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59737274..59737362 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039585 (AC131749.2)  

 
Come back to gene ENSMUSG00000039585


For any suggestions or comments, please send an email to unitrap@crg.es