Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST66410
Clone ID OST66410
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST66410
Sequence
AACCTGCAATACAACCGGAGCCNGAANCCGTTTGCAACGTGGCCATCAGCTTTGATCGTTGCAAGATTACCTCAGTGACC
TGCAGCTGTGGAAACAAGGACATATTTTATTGTGCCCATGTTGTGGCACTGTCTTTATACCGCATCCGCAAGCCAGAGCA
GGTCAAACTGCATCTTCCCATTTCANAGACTCTCTTTCAGATGAACAGAGACCAGCTACAAAAGTTTGTTCAGTATTTGA
TCACAGTGCACCACACAGAAGTCTTGCCAACTGCACAGAAGCTAGCAAATGAAATTCTCTTCCCNAAATTCNAAAATCAA
CCAAGTTTCC
Sequence Type mRNA
Unitrap ID UNI27224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108577851..108578176 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]

 
Come back to gene ENSMUSG00000032846


For any suggestions or comments, please send an email to unitrap@crg.es