Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC269
Clone ID RRC269
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC269
Sequence
CTTTCAAGACCTTGGAACTGATCTCAACAGAAGGAGAGCGACAGCCTAAGTCCT
Sequence Type mRNA
Unitrap ID UNI8608

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31846892..31846942 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es