Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST66131
Clone ID OST66131
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST66131
Sequence
GACTGAGGTGATATATCCTNAGCATTCCAAACTTACTGATAAAGAAAAAACCAATATNTGCTACTTGTCTTTTCCNGACT
CAAATTCAGGTTGTCTTGGAGATACCCAGTTTTGTTTTAGATTCCGACAGTCTTCTGGGAGAAGGGTGTCACTACACTGN
CTTCTTGATGANTTTGACAAAGATTTACCAGTTTACTTAAAGAANGATCCTGCATATTTTTATGGATATGNGTATTTTCG
ACAAGTTCGAGATAAAACTCTTAAAAGAGGCTACTTTCAAAAGGTA
Sequence Type mRNA
Unitrap ID UNI8387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27411717..27420013 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]

 
Come back to gene ENSMUSG00000040818


For any suggestions or comments, please send an email to unitrap@crg.es