Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65873
Clone ID OST65873
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65873
Sequence
GAACTGAGATTTTAGGTGATGGGAAGATCAGAAAGTCAGATGGATATAACTGATATCAATGCTCCAAAGCCAAAGAAGAA
ACAGCGATGGACTCCCCTGGAGATCAGCCTCTCTGTGCTTGTCTTGCTCCTGACTATCATAGCGGTGACAATGATCGCTC
TCTATGCAACCTATGATGATGGCATTTGCAAATCATCAGACTGCATAAAATCAGGTGC
Sequence Type mRNA
Unitrap ID UNI17847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63104045..63104938 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027820 (Mme) NM_008604 membrane metallo endopeptidase Gene [Source:MGI Symbol;Acc:MGI:97004]

 
Come back to gene ENSMUSG00000027820


For any suggestions or comments, please send an email to unitrap@crg.es