Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65867
Clone ID OST65867
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65867
Sequence
CTGAGCCTGTTAAATGCCAGTGGCCTGACAGCAGCAGACATTGCACAAACCCAGGGTTTCCAAGAGTGCACCCAGTTTCT
CTTGAGCCTCCAGAACCATCAAATGAGCCGTTTCTGTCATAATGGCACCTTGAGTGGAGGTCATGAGAGCATACTGCCCA
CTCACGTTAGCCTGGGAACAAACCGAAAGAGATGCCTGGAAGACTCAGAATCTTTGGGAGTGAAGAAAGCTAGAACCAGA
GTTCCCAGCCTGGATCACGCCATGCCTNTAACAAATGGANANGCTNNAAAANAANCCCANNNAANGNACGTGGACNGANA
NTGTGCTGNTGNATNANGTGGGACTGGACAGTTTNCTGTTAGCTGGAACAACACCCCA
Sequence Type mRNA
Unitrap ID UNI27241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11615774..11619299 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031508 (Ankrd10) NM_133971 ankyrin repeat domain 10 Gene [Source:MGI Symbol;Acc:MGI:1921840]

 
Come back to gene ENSMUSG00000031508


For any suggestions or comments, please send an email to unitrap@crg.es