Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65840
Clone ID OST65840
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65840
Sequence
GAACTGAGGACCGTTCTCATTTCCTTTTGGGAGTATTCATGCTTCACCATGTTGAGAGCTAAGAATCAACTTTTTTTGCT
ATCGCCCCATTACCTGAAGCAGCTAAACATTCCATCAGCTTCCAGATGGAAACGCCTTCTACACCAGCAGCAACCCCTTC
ACCCAGAATGGGCTGTACTGGCCAAAAAGCAGCTGAAAGGCAAAAACCCAGAGGACCTTATATGGCACACCCCAGAAGGG
ATCTCTATAAAGCCCTTATATTCCAGGGCAGATACTCTGGACTTACCCGAAGAACTTCCAGGAGTGAAGCCATTCACACG
GGGACCATATCCTACCATGTATACCTATAGGCCCTGGACCATCCGTCAGTATGCAT
Sequence Type mRNA
Unitrap ID UNI27243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 41073991..41074359 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023921 (Mut) NM_008650 methylmalonyl-Coenzyme A mutase Gene [Source:MGI Symbol;Acc:MGI:97239]

 
Come back to gene ENSMUSG00000023921


For any suggestions or comments, please send an email to unitrap@crg.es