Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65813
Clone ID OST65813
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65813
Sequence
CTCCGATGGACCAACGTGGNCANNATGGATCTGTCCAANAAGGNCAAACTGNTGNNCATTGCAGGGACCCTCCNCNTACT
TGCTGNAACCTGAGGNANGGCTGGNTATNTNGTGGTACGCCGTCAACATCACTACTGACTTCTTCAACCCACTGTATGCT
GGAACCAAGTATGAACTGGGCCCCGCCCTCTACTTGGGCTGGA
Sequence Type mRNA
Unitrap ID UNI27245

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137448270..137450514 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001739 (Cldn15) NM_021719 claudin 15 Gene [Source:MGI (curated);Acc:Cldn15-001]

 
Come back to gene ENSMUSG00000001739


For any suggestions or comments, please send an email to unitrap@crg.es