Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XL142
Clone ID XL142
Vector pGT0Lxf
Project baygenomics

Sequence tag XL142
Sequence
GCCCGGAAATGATTGTGGAGGAACATGGCGTTGCTGGTGCGAGTCCTT
Sequence Type mRNA
Unitrap ID UNI4822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155755749..155755795 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]

 
Come back to gene ENSMUSG00000005882


For any suggestions or comments, please send an email to unitrap@crg.es