Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65655
Clone ID OST65655
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65655
Sequence
CACACTGAGGGTGTTGTGACCTATGATGATGTGCATGTGAACTTCACTCAGGAAGAGTGGGCTTTGCTGGATTCTTCTCA
GAAGAATCTCTACAGAGATGTGATGCTGGAGACCTACAGGAATCTTGCTGCTATAGGCTACAGTTGGGAAGACCATAATC
CTGAAGAACATTTTCAAAGTTCTAGAAGACATGGAAGGTAATCTGCATGTGGAAACTGATAAAAATGGCTCTGAATTAAA
TTTTTAGGGGGGCCCTGNCAAATTTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI3370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150236604..150237075 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068130 (Zfp442) zinc finger protein 442 Gene [Source:MGI (curated);Acc:Zfp442-001]

 
Come back to gene ENSMUSG00000068130


For any suggestions or comments, please send an email to unitrap@crg.es