Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65618
Clone ID OST65618
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65618
Sequence
AACTGAGTGCACTGCTGAGACCTTTATTTCTACTGCATCACCGTCCATATAAACACGAGCAAGCCCTGACTACAACACAC
TATACCACTGTTGAGAGCTCCGAGGTGTAATGGGGATGGGGGACATTGAAGGGATTTGCTGGAGCCATCCCCAACAAACA
GCAAACATAAACATTAAAAAAAGAAAA
Sequence Type mRNA
Unitrap ID UNI15629

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174122228..174122408 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027523 (Gnas) NM_019690 GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus Gene [Source:MGI (curated);Acc:Gnas-007]

 
Come back to gene ENSMUSG00000027523


For any suggestions or comments, please send an email to unitrap@crg.es