Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65578
Clone ID OST65578
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65578
Sequence
AGCACAAAACACATTCNNATTGAATAAGAAGAAAATATTTAAGGGCCACATGGTANCAGGCTACGCTTGNCAGGTAGACT
TCTCACCANACATGAGCTATGTGATTTCAGGAGATGGAAATGGGAAATTAAACATCTGGGACTGGAAGACCACAAAACTC
TACAGTCGCTTTAAAGCCCATGATAAAGTGTGCATAGGCGCAGTGTGGCACCCCCATGAGACCTCCAAGGTCATCACGTG
TGGGTGGGA
Sequence Type mRNA
Unitrap ID UNI27255

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40553010..40554077 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038446 (Cdc40) NP_082155 cell division cycle 40 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918963]

 
Come back to gene ENSMUSG00000038446


For any suggestions or comments, please send an email to unitrap@crg.es