Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0395
Clone ID BC0395
Vector pGT2lxr
Project sanger

Sequence tag BC0395
Sequence
GCCGGTCTTGTGCGGAGATTGGAGGCGTCCTTGCGGGCTCCGGCCCGGAGAGGGGGGGTGTCGGCGTTGGAGTTGTGAAT
TCGCTGCGTTTCCATGAAATCCTGCGGAGTGTCGCTCGCTACCGCCGCCGCCGCCGCCGCCGCCGCCGCTTTCGGTGATG
AGGAAAAGAAAATGGCGGCGGGAAAAGCGAGCGGCGAGAGCGAGGAGGCGTCCCCCAGCCTGACAGCGGAGGAGAGGGAG
GCGCTCGGCGGACTGGACAGCCGCCTTTTCGGGTTCGTGAGGTTTCATGAAGATGGCGCCAGGATGAAGGCCCTGCTGGG
CAAGGCTGTTCGCTGCTACGAATCTCTAATCTTAAAAGCTGAAGGGAAAGTGGAGTCTGATTTCTTTTGTCAATTAGGTC
ACTTCAACCTCTTATTGGAAGATTATCCAAAAGCATTATCTGCATACCAGAGGTACTACAGTTTACAGTCTGATTACTGG
AAGAATGCTGCCTTTTTATATGGTCTTGGTTTGGTCTACTTCCATTACAATGCATTTCAGTG
Sequence Type mRNA
Unitrap ID UNI912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17740039..17794122 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es