Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65273
Clone ID OST65273
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65273
Sequence
GACTGAGGTGTGCAACAGAAGAACATGGCTCAAGAAACTAATCACAAGCCAAGCACCTATGCTTTGCTCCACTGGCTGCG
GATTTTATGGAAACCCTCGTACAAATGGCATGTGTTCAGTATGCTATAAAGAACATCTTCAAAGACAGAACAGTAGCAAT
GGTAGAATAAGCCCACCTGCTNCTNTTGNNANTACGANGCATGAATCNTTACNAGAGCANAGCGCNGATGNNGNAGTACT
AGACNCTCANTCAANACTANATTCTACGTCTTCATNTATGCAGCCAGGCCCTGTGTCAAATCAANCACTTTTATNAGAAT
CTGNAGCACCTTCCCAAGTGGACAGTNCATCTGTGGACAAAGCAGTATCCNAGACAGAANACCTGCNAGGACCCACAACA
GAAGGCCTTGTTACCAGCTTAAGCCCCCTTGAACCATGAAAAA
Sequence Type mRNA
Unitrap ID UNI14696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 91781165..91782921 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030629 (Zfand6) NP_075361 zinc finger, AN1-type domain 6 Gene [Source:MGI Symbol;Acc:MGI:1929510]

 
Come back to gene ENSMUSG00000030629


For any suggestions or comments, please send an email to unitrap@crg.es