Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65266
Clone ID OST65266
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65266
Sequence
CTCACCAGATCAAAACCCTGNNNANCNCTCGNGTAGNACNNTNNTTCCAATGCCNAGGNGCCCCNNGAACTGCTGGAAGA
AATGCTTTGGTATTTTCGTGCAGAAGATGCGGCTCCTTGGAATTATTCCATCCTGGTCCTGGCAGTCCTGGTGGTCATGA
CAAGCATGTTCCTCCTGAGAAGGAGCATCCTGGCAAACAGAAATCGAAAGAAGCAGCCACAAGACCAAGAAACACCAGAA
GACCTGCATCTTGATGACTCCATAATGAAAGAGAACAACAGCCAGGTCTTCCTAAGAGAGACATTGATCTCAGAGAAACC
AGACTTGGCCCCGGGGGAACCTGAGTTGAAAGAGAAAGACTCATCACTTGTCTTTCTGCCANACCCACAGGGAACAGAGA
AGT
Sequence Type mRNA
Unitrap ID UNI27272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65260609..65263036 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053862 (Ostb) NM_178933 organic solute transporter beta Gene [Source:MGI Symbol;Acc:MGI:3582052]

 
Come back to gene ENSMUSG00000053862


For any suggestions or comments, please send an email to unitrap@crg.es