Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65197
Clone ID OST65197
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65197
Sequence
GAACTGAGGGTGCGCCCCGAGATCCCGGTAGCTTCATAACTGCGGCGGTGATGGATGAAGCCGTGGTGGGAAGGGCGCGT
CGCCTCGGACGTACACTGCACTCTGCGCGAGAAGGGAAAGGACCTGGAGATCCAAGAACTTGAAGTCGGTTTTTCACCAG
CCACCTAAATGAAGAATAGTTCGTATCCCATTGGATTTCCTCCCGAGGTTACTTTACATGGTACAAGAATGGATTAAAAA
AAATACTGTGTATCCA
Sequence Type mRNA
Unitrap ID UNI27276

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 43342855..43343273 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044707 (Ccnjl) NM_001045530 cyclin J-like Gene [Source:MGI (curated);Acc:Ccnjl-001]

 
Come back to gene ENSMUSG00000044707


For any suggestions or comments, please send an email to unitrap@crg.es