Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST65183
Clone ID OST65183
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST65183
Sequence
CATTCCTGGGGACAAGAAGAACAAGCCCTACAACTGCCACCAAGGACTCANGGAAGCCGCTACACATCAAACCACGCCTG
TGAGGCCCCCTGAGGACCAGCCCGCACCTACCTCAGACCCTCACCCCTGGAGAGGATGAAGGCTCTACCCACAACTGCTC
CTGAGGAGAAGCAGCCTGCCACTGAGCCCAGCTGGGGCTCTAACCAGGAGTCATAGCTCCTCCCACTTGGCTCCTAGCCT
CTGGAGGCCTTTGTGTGCCCAGGCCTTGTTCTCCCTCAAGCCAAGGCCCTGTCCATTCCCTGTTCCTCTCCCTCCCCTTC
TCCAA
Sequence Type mRNA
Unitrap ID UNI27277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3108780..3110565 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055452 (AC132586.3)  

 
Come back to gene ENSMUSG00000055452


For any suggestions or comments, please send an email to unitrap@crg.es