Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK086
Clone ID RRK086
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK086
Sequence
GATTTATCATAGATGAAGAACTTTTTGGACAGACACATCAGCACGAACTGAAAACCGGAGGATCAGAGATTGTTGTCACC
AATAAGAACAAAAAGGAGTATATCTACCTTGTAATACAATGGCGATTTGTGAACCGTATCCAGAAGCAAATGGCAGCTTT
TAAAG
Sequence Type mRNA
Unitrap ID UNI8630

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72586911..72588033 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es