Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64977
Clone ID OST64977
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64977
Sequence
GACTGAGAAGAACGGTGGCAGAAGCTCCAGGAGTACCTGGCAGNCCAGGGAAAGCTAAAGGACCCCAACGCCAAGCCTTA
TCTAAAAGCCAAGAATATCTGCCCCAAACCACCACCATCTAAATATNCTCNTGGACCTACNTGANTTGTATGANNTAANN
TTGGGNCNAGAATGCTTTNAGAATNAATTAANATGCTGNACCANNATGCCTNANTCAGNATTANANGATGNGACAAGCNN
GAGTNGNANCCACCTCCTCTTCCAANCAGAGGACTNTCGTGTNGATGNTTTTCTTCTAACACAGACTGNNAACAGTCCAG
CAAGCCTCAGCAGCAACCTAGAGCAGTGTCATCCACTGCAGGACTGTCAAGAAACCCCAGGCAGTGCCCTGATATACAGG
AACTAAAAACCAAACAGCANCAGCGAGCACATGGAGGAAATAAG
Sequence Type mRNA
Unitrap ID UNI27286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129111522..129122118 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048327 (Ckap2l) NM_181589 cytoskeleton associated protein 2-like Gene [Source:MGI (curated);Acc:Ckap2l-001]

 
Come back to gene ENSMUSG00000048327


For any suggestions or comments, please send an email to unitrap@crg.es