Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64939
Clone ID OST64939
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64939
Sequence
TGACTGAGGGTCTTCAAGAGCAGATGCTGAAGAAGGTATACTAGAACTGTTAGGAATACCTTAGTGAACACTGTTTCCAC
TGACGTTCGCATAGTGAATTAAAACGTCATTAAAATGCACATTACAGTCAACTTTTGCTTAATATGGTCTATGAAAGTGG
AAAATAAACATCTAATGCCATAA
Sequence Type mRNA
Unitrap ID UNI27289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41486057..41486238 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059834 (Sclt1) NM_001081411 sodium channel and clathrin linker 1 Gene [Source:MGI Symbol;Acc:MGI:1914411]

 
Come back to gene ENSMUSG00000059834


For any suggestions or comments, please send an email to unitrap@crg.es