Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64911
Clone ID OST64911
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64911
Sequence
AAACACTGAGGAGCTGCACTCATTGCACTATGGACTCTACTCTGGGCCCTTATAGGTCAAGAAGTTCTCCCTGGTGGAAA
TTNGTTTGGACTTGTAGTTATTTTTTACAGTGCTTTCCTTGGGGGTAAAATTTTAGAATTCATTAAAATACCTGTAGTGC
CTCCCCTCCCACCTCTCATTGGGATGTTACTGGCTGGTTTCACCATCAGGAATGTNCCGATTATTTATGAATTTGTCCAT
ATTCCTACCACATGGNCTTCAGCTTTAAGAAACACTGCCCTTACTATTATCCTANTACGAGCTGGGCTTGGACTGGATCC
ACAGGCCTTGAAGCATCTGAAGGGAGTCTGTCTGCGCTTGCATTTGGTCCATGCTTCCTAGAAGCCTGCTCAGCCGCTCT
CTTCTCCCACTTCATTATGAACTTTCCTTGGCAATGGGGGTTCCTACTAGGGNAATATTTTTTCCTTTCCTCATAACATG
GAGATTACNCAGCTAAATGGTTTTGATTAAAGCTTTANATACTCTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135034807..135037440 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050150 (Nhedc1) NM_028946 Na+/H+ exchanger domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921696]

 
Come back to gene ENSMUSG00000050150


For any suggestions or comments, please send an email to unitrap@crg.es