Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64847
Clone ID OST64847
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64847
Sequence
CAGACTGAGAATTTTCNATTTGTCCCTGAACGAACGCTGCCTTTCTGCATCGTTGGTTTGCAAGTACTGGCGTGACCTTT
GCTTAGATTTCCAGTTTTGGAAGCAGCTGGACCTTAGTAGTCGTCAGCAGGTTACTGATGAATTATTGGAAAAAATTGCC
TCCAGAAGTCAGAATATAATTGAGATTAACATTTCTGATTGGNGAAANNTGACNAACAGNGGNGGGGGTGTGCTAACATG
GAAAAGTCCTGGACTTCTTAAGT
Sequence Type mRNA
Unitrap ID UNI27291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 63837186..63840240 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023965 (Fbxl17) F-box and leucine-rich repeat protein 17 Gene [Source:MGI Symbol;Acc:MGI:1354704]

 
Come back to gene ENSMUSG00000023965


For any suggestions or comments, please send an email to unitrap@crg.es