Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64815
Clone ID OST64815
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64815
Sequence
CTGTAGCTGGTCATTACATCTCCCCTTTCCCGACATTCCTCTGAAGGCGGACTGTAAAGAGGAACATGAAATTCTTGAGC
CATTCCATCCAGTGCGTTGAANTTTTNAAAAGGCTTGTTCCTGTTCCTCTTCACCACAACCTGAATATTTTCTGAGTTTT
ATGGGATTTTCTGTGACAGTGAAGTTTANGTTAAGATGTTAACACTGTTATTAAAATAGCTATTACACAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104556145..104556305 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030647 (Ndufc2) NM_024220 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2 Gene [Source:MGI (curated);Acc:Ndufc2-001]

 
Come back to gene ENSMUSG00000030647


For any suggestions or comments, please send an email to unitrap@crg.es