Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64813
Clone ID OST64813
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64813
Sequence
GAGGAAAAAAGGGTGCGCAAGTCAACCAGCAGCAGCAGTGCGTCTCCCTCCCTCTATGAGGATCCAGTACTGGAGGCCAT
GTGCTCCAGGAAGAAGCCTCCAAAATTCTTGCCCATCTCATCAACACCCCAGCCAGAGAGAAGGCAGCCACCGCAGAGGC
GCCACTCCATTGAGAAGGAAACACCTACGAACGTGAGGCAGTTTCTGCCACCATTCAAGCCGAACTTACGGGCCTNTTGT
AAGTACCAAAAGATGG
Sequence Type mRNA
Unitrap ID UNI27293

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67663068..67665398 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024533 (Spire1) NM_176832 spire homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915416]

 
Come back to gene ENSMUSG00000024533


For any suggestions or comments, please send an email to unitrap@crg.es