Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64793
Clone ID OST64793
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64793
Sequence
CTGAGAGACGTGTGTGCGGCCCCGGGCCATGCTGATCCTGGTACCTCTAAGTCCCTCAGCTCAGAGCTGCTCACCTGCAG
TCCCCAGCACCGGAAAGCAACATGGTCAGGAGGGGTGAAGCTTCGGCTAAAGCAGAGGTGCAGTGAGCCTGCCACTCGCC
CTCACTCGTGGCATACCACCAAATTTGGGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93348669..93362833 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es