Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK134
Clone ID RRK134
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK134
Sequence
TGAGAGAATTCAAGACTACAAATCGGCTGTTGCTAACAGGGACGCCTCTTCAGAACAACCTGCATGAGCTCTGGTCACTT
CTAAACTTTTTGTTACCAGATGTGTTTAATTCAGCTGATGACTTTGATTCCTGGTTTGATACAAATAATTGCCTTGGGGA
TCAAAAGCTAGTTGAGAGGCTTCATAT
Sequence Type mRNA
Unitrap ID UNI8640

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83248069..83250007 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031715 (Smarca5) NM_053124 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Gene [Source:MGI (curated);Acc:Smarca5-001]

 
Come back to gene ENSMUSG00000031715


For any suggestions or comments, please send an email to unitrap@crg.es