Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0386
Clone ID BC0386
Vector pGT2lxr
Project sanger

Sequence tag BC0386
Sequence
TTCTATCCTTCTCTGCTNTGACCCGTCTCGGAACTTAGATCTTCCATTTCGATTGTTCATACTCTCTTGATCGATTATAT
TCTATCATTTTATTTTATTATTTGCTCCTTTCTCCCTAGATTGTATCCTCTCGTTCCCCTCCGTCTTGAATCGATCTACA
ATTCTCGCTTCATACGATCACCCAGCTAGGTTCCTTTGTTCATCCTTGCCTTTCCGTTTAGAGCAGGCTGAAAGTTTGGT
CTGATTTGTTTTAATCTCTGCTGCCAGGGGCCTTAGGGAATTGCCAGCGATCTACGACGTGGCGACATGAATGCAGTGAC
TTATGAGGACCTGCATGTGAACTTCACTCAAGAGGAGTGGGCTCTGCTGGATCCTTCCCAGAAGAAGCTCTACAAAGATG
TCATGGTGGAGACCTACAGGAACCTCAATGCTATAGGCTTTAATTGGGAAGCCCATAATATCGAAGAATATTGTCAAAGT
TCTAGAAGACACAGAAG
Sequence Type mRNA
Unitrap ID UNI914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62558047..62568185 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055228 (8430426H19Rik) NM_178875 RIKEN cDNA 8430426H19 gene Gene [Source:MGI Symbol;Acc:MGI:1918758]

 
Come back to gene ENSMUSG00000055228


For any suggestions or comments, please send an email to unitrap@crg.es