Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64612
Clone ID OST64612
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64612
Sequence
AAGTGGATCCACACCTACACTACTGTGTAGGCTGACACCTGGATGGATGGTATATGAATGCTATGAATCAGAGTCACCTA
GCTAGGCCAATCCCAGAACCCCGACCGTCTAAAACCACAGATGTTTGTTTTGTCTTGAGACTGTGTAACTCAATTTGTGA
ATTGGTGCTTAGTTCCCTTGCCCCTTGAGCCTCACACAGGCTCGAACTTAATGCATGCAGCAGCATGCCTGATATACTCA
TTA
Sequence Type mRNA
Unitrap ID UNI27298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7724796..7725038 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]

 
Come back to gene ENSMUSG00000055188


For any suggestions or comments, please send an email to unitrap@crg.es