Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK171
Clone ID RRK171
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK171
Sequence
GGACTCTGCAATATGAATAATTCTTTAGAGAACACCATTTCATTTGAAGAGTACATCCGAGTAAAGGTGAGGTCTGTCCC
GCAACACAGGATGAAGGAATTTCTGGACTCACTGGCTTCTAAGGGACCAGAAGCTCTTCAGGAGTTCCAGCAGACTGCCA
CCACCACCATGGTGTACCAGCAGGGTGGGAACTGCATTTATACAGACAGCACTGAAGTGGCTGGGTCTTTGCTTGAACTT
GCTTGTCCAGTCACAACCAGTGTTCAACCACAAACTCAGCAAGAGCAGCAGATCCAGGTTCAGCAGCCACAGCAGGTT
Sequence Type mRNA
Unitrap ID UNI4175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108430929..108431246 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es