Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64300
Clone ID OST64300
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64300
Sequence
TGAGGATGAAGTATGATGTTCAGTCTTGGAATATCTTCAGGAGTCCCAGGCAAACTGTGAAGCTGGAATGCNTTNCGGGN
TTTACTGGANAGGCACCGNGTACNCACANCNNGAAGTGAGGGAACTTCTTGGCCGCCTGGATCTGGGAAACAAGAACAAA
GATGAACCANAAAGGATCCTCCGGGTTGTTTCGAGCCGTCTCAACTTTTGGAGTCGTANGTTTTGTCAGGTTCTTAGAAG
GCTACTATATTGTATTAATAACTAAGCGGAGGAAGATGGCAGACATTGGAGGTCATGCAATTTATAAAGATTGAAAGATC
AAAGTATGATTTATATCCCCAATGACTCTGTTCGGATTTCTCACCCCGACGAAGCTAGGTATGT
Sequence Type mRNA
Unitrap ID UNI27301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40997158..41005217 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038417 (Fig4) NM_133999 FIG4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143585]

 
Come back to gene ENSMUSG00000038417


For any suggestions or comments, please send an email to unitrap@crg.es