Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST64063
Clone ID OST64063
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST64063
Sequence
ACACTGTGATACAACTGTGGCAGCCCTCCTGAAATTCATAACGCCATCTTGGTCGGGAATCACAGCTCCAGACAGGGGAG
TGTGGCTCATTATGACTGTCANGAGGGCTTTGNGAGTCCANGAGGAAAGATCACTTCCGTTTGCACAGAGAAAGGCGCCT
GGAGTTGAAATCACTTATGCATTGCACAGGTACAAGACTCCTTTCTGCTGGCCTCCTGTTACCTGGGAGCAACACCANAG
GGGTCATGGAGTAATGGCTGCCTCTGGGTCANCTCACCTCTCCCGTTTACTCGGGTAGGCATTTGGCTTCGGGATCTACC
CA
Sequence Type mRNA
Unitrap ID UNI25915

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59403316..59403620 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038578 (OTTMUSG00000007332) predicted gene, OTTMUSG00000007332 Gene [Source:MGI Symbol;Acc:MGI:3651543]

 
Come back to gene ENSMUSG00000038578


For any suggestions or comments, please send an email to unitrap@crg.es