Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST63969
Clone ID OST63969
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST63969
Sequence
ACACTGAGCTCAGACACATGTCCTCACGTACATGGAGGATGCANGTGTGCCAGCTGCTGGAGAACAGGGAGGATATTAAG
CCAGTATGGCATTGCCCGGTTCTTCACTGACTAGTCTCCANAGGCTCTTTGGACATCANACAGCTGTTCTAATGGCCTAA
ACAATGTGGGTTGTTATTAAAGGAATATTTGACCCTCCCTACCTTTTTTGTTGAGNTAGAGNTTTCAGAAATAAAATTGA
TGAAATATAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91258938..91262127 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040591 (1110051M20Rik) NM_175123 RIKEN cDNA 1110051M20 gene Gene [Source:MGI Symbol;Acc:MGI:1915079]

 
Come back to gene ENSMUSG00000040591


For any suggestions or comments, please send an email to unitrap@crg.es