Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST63964
Clone ID OST63964
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST63964
Sequence
CCAGTCCATTCTGATCCCACCCTCTGAGCTGGAGACCAATCCTGCCTTGTGGCTTCTTGCTGTGAGTCAATACAAAGTCC
GGGATACCTTCTGTTCCTATTCGGTGATGGAGCTTTGCACCGAAAGGGCTGGGCTCACAAACTGAGTCCCTCAAGGCACG
AGGCTTGGACTTGTCCCGGGTAAGAACCTGTGTGGTTGTGGCANAAGAGCGTCCCCGAATCGCCCTTACACAAGNCTTTT
TCAAAGCTCTTTAAAGGACTTGGGTCTTCACCCACNANCNTGNTAANTACTTCAATTTTGGGCCTGGCAGAGTTGAACCC
CTNGGCCAATTTTNGNTTAACAAGGGGGGAACAATTCAAAGGAACCTTG
Sequence Type mRNA
Unitrap ID UNI14337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9633983..9636478 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048264 (Dip2c) NM_001081426 DIP2 disco-interacting protein 2 homolog C (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920179]

 
Come back to gene ENSMUSG00000048264


For any suggestions or comments, please send an email to unitrap@crg.es