Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK232
Clone ID RRK232
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK232
Sequence
CACTTGACCCGCGCTTGCGAGCTCCGCTGCCAGGCCCTGTGGGGAGAGTGCAGTCGAGATCGGAAGCCGCGCCAT
Sequence Type mRNA
Unitrap ID UNI8660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 46773159..46773233 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068959 (Zfp619) NM_001004139 zinc finger protein 619 Gene [Source:MGI (curated);Acc:Zfp619-001]

 
Come back to gene ENSMUSG00000068959


For any suggestions or comments, please send an email to unitrap@crg.es