Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST63925
Clone ID OST63925
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST63925
Sequence
GAGGATTTAGTCCCTATGATGACGTGCATGTGAACTTCACTCAGGAAGAGTGGGCTTTGCTGGATGCTTCTCAGAAGAGT
CTCTACAAAGGTGTGATGGTAGAGACCTATAGGAATCTCACAGCTATAGGTTACAGTTGGGAAGAACATACAATTGAAGA
CCATTTCCAAACTTCTAGAAGTCATGGAAGGTAATTTTCCTCTGCAAGCTGATGAGAAAATGCCTATGAAGAAAGTTTAA
CGTGTGCTACAAGTAGTAAAGAAAACCAATAGGGTACAATAAGCACTGCTTTCAGTTATGGATGTTTATTGAATTTCATA
AAATCATATATGTCTATGGCAGATATGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17437

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175596731..175694847 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078889 (OTTMUSG00000016618) NP_001028295 predicted gene, OTTMUSG00000016199 Gene [Source:MGI Symbol;Acc:MGI:3706570]

 
Come back to gene ENSMUSG00000078889


For any suggestions or comments, please send an email to unitrap@crg.es