Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST63816
Clone ID OST63816
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST63816
Sequence
ATGCTAAATACCGCCGGNATNCTGACNGGNGGNTACACNGATANTNGNACNTACCANCANNTTGNNGCCTCAAGTGAGAN
TAANGANTTAATGGNGTATTAAACTTNNANAACCAGGNGGCCTTGGCAACGNNCNNATCTTCAAAACACTCAANNAAATC
ACCGNAGGAAAAACCGTCCAGATCCCCGTGTCGACTTTGTCTCCCACTCACGGAAAGAGGAGACGGTCACCATCTACCCC
GCCGACGTGGTGCTCTTCGAAGGGATCCTAACCTTCTATTCCCAGGAGGTCCGAGACCTGTTCCAAATGAAACTTTTTTG
TGGACACAGATGCGGA
Sequence Type mRNA
Unitrap ID UNI13064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 169164843..169166833 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026558 (AC142244.11) NM_030724 Uridine-cytidine kinase 2 (UCK 2)(EC 2.7.1.48)(Uridine monophosphokinase 2)(Cytidine monophosphokinase 2) [Source:UniProtKB/Swiss-Prot;Acc:Q99PM9]

 
Come back to gene ENSMUSG00000026558


For any suggestions or comments, please send an email to unitrap@crg.es