Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK259
Clone ID RRK259
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK259
Sequence
ATCTGGGGTCTGGAGGACGACGAGGACATGACACTTACAAGATGGACAGGCATGATAATTGGACCTCCACGA
Sequence Type mRNA
Unitrap ID UNI8667 UNI8668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 78964484..78964553 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072978 (AC163007.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167443329..167443398 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078923 (Ube2v1) NM_023230 ubiquitin-conjugating enzyme E2 variant 1 Gene [Source:MGI (curated);Acc:Ube2v1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60681167..60681236 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027694 (AC122503.4)  

 
Come back to gene ENSMUSG00000027694


For any suggestions or comments, please send an email to unitrap@crg.es