Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST63609
Clone ID OST63609
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST63609
Sequence
AGACTGAGATTTGGTAGCCCANCACAATGANAGCTCACAGGGGACTCATCTTACTCCTGCTGCTTCTGGCTGTCTTNTGT
TCCACANCTGTTANCCTCACATGCTACCACTGTTTCCAACCGGNGGTTTCTTNATGCAATATGAACAGCACTNGCTCTCC
TGACCAGGATTCCTGNCTCTATGCTGTACCCGGAATGCAAGTGTATCANAGGTGTTGGAAACAATCAGATTGTCATGGTG
AGATCATTATGGACCAATTAGAAGAGACAAAATTAAAATTCAGATGCTGCCAGTTTAAAAA
Sequence Type mRNA
Unitrap ID UNI18980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103919013..103954237 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032679 (Cd59a) NM_007652 CD59a antigen Gene [Source:MGI (curated);Acc:Cd59a-001]

 
Come back to gene ENSMUSG00000032679


For any suggestions or comments, please send an email to unitrap@crg.es