Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK304
Clone ID RRK304
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK304
Sequence
TTCAAAAACTTTATTTTTTTTATGAAGAAGGAGAAAAAGAACCCGAGGTTAAGCAGAAATTAAGAAGAAATGTGAACTTG
TTAGAGAAGCTTGTTATGCAGGAGACTTTGTCGTGTTTAGTAGTCAATCTGTACCCAGGAAATGAAGGCTATTCTCTGAT
GCTCAGGGGGAAAAATGGATCAGATTCTGAGACCATCCGATTGCCTTATGAAGAAGGAGAATTGCTTGAATACTTAGATG
CAGAAGAATTACCTCCTATTTTGGTGGATCTCCTTGAAAAATCA
Sequence Type mRNA
Unitrap ID UNI3386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54502526..54507093 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027751 (D3Ertd300e) NM_019995 Protein FAM48A (p38-interacting protein)(p38IP) [Source:UniProtKB/Swiss-Prot;Acc:Q7TT00]

 
Come back to gene ENSMUSG00000027751


For any suggestions or comments, please send an email to unitrap@crg.es