Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST63242
Clone ID OST63242
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST63242
Sequence
CACTGAGGGAACCCTTCCTTGGAGAAGTGTCGCGCTCTGAAGCTGCAGCGGGAAGAGGCAGCTGAAGTGGCTGCCCTGGA
TGTTGCCAACATCATCAGCAGTACAGGCCGGCCACGAAGACGAAATGCCTGGAACCCTTCAGGGGAAGGGACCTCCCCAG
GAGAGACTTATCGCCGAACCCTGGACTCAGAAGAGGAGCAGCCGCGCCAAGCACCTCCAGACTGGTCCCATATGCGTGAT
ATCATCAGCAGTGACGGTGACAGCAGCTGAACTCCCGTGTCCATGGTGGACCTTACCCTGTTATACAAGAGCCTGGTCAG
TGGAAGCAACTTCCAAAGACAGACTACAGTGGCAGGATCCAAGTTATTGGCACACTACTCAATTTCATGGTTCTC
Sequence Type mRNA
Unitrap ID UNI27327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134008075..134008535 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042606 (Hirip3) NM_172746 HIRA interacting protein 3 Gene [Source:MGI (curated);Acc:Hirip3-001]

 
Come back to gene ENSMUSG00000042606


For any suggestions or comments, please send an email to unitrap@crg.es