Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST63223
Clone ID OST63223
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST63223
Sequence
TGACATTGGCGGTTCGTGCTTCAGCGCCTGGTCTTCCTGGCAGCATTTGTGGTATATTTGGAAACAGAGACCCTGGTGAC
CCGAGAGGCTGTTACAGAGATTCTTGGCATTGAACCAGATCGGGAAAAAGGGTTTCATCTGGATGTGGAAGATTATCTCT
CAGGAGTTTTAATTCTTGCCAGTGAACTGTCGAGGCTGTCTGTCAACAGTGTCACTGCTGGAGACTACTCTTNGGCCCCT
TCACATTTCTACTTTCATCAATGAGCTGGATCCTGGATTTTCGTCTTCTTCAATCTGGAAAAATGACCTCCCTGGAGGAA
AGCCGCTACCNACNGGCTTGAAGTACNANTGTGGAANAAAAGTTNGAGGGAGGGGGGNCTTATTGACCTTTCCATCCGAG
GGCTTC
Sequence Type mRNA
Unitrap ID UNI25338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 120197417..120201882 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026374 (Tsn) NM_011650 translin Gene [Source:MGI Symbol;Acc:MGI:109263]

 
Come back to gene ENSMUSG00000026374


For any suggestions or comments, please send an email to unitrap@crg.es