Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK343
Clone ID RRK343
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK343
Sequence
TCCTGGAGCTGGGCGACGCGGGCGCGGCGGGCCAGCCGGTTCTCACGAACCCTTGGAACATAATGATAAAACATCGGCAG
GTGCAGCGAAGGGGCCGCCGATCTCAGATGACCACAAGTTTCACAGACCCAGCCATCTCTATGGATCTCCTCCGTGCTGT
CCTGCAGCCTAGCATCAATGAGGAGATCCAGGGTGTCTTCAACAAGTACATGA
Sequence Type mRNA
Unitrap ID UNI8633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164571613..164573057 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es