Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK351
Clone ID RRK351
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK351
Sequence
AAGAAAATGACAGAGTGTTTGGAAGATTATTACTTTTGGAAGTCCTGCTAATATCCATTTCCTAAGAGATAGTTGACCAA
CATTGACTCTGGCATGGCGCAAAACAGTCCACAGCTTGATATTCAGGTTCTCCATGATCTTCGACAACGTTTTCCTGAAA
TTCCAGAGGGTGTGGTATCCCAGTGCATGTTA
Sequence Type mRNA
Unitrap ID UNI8681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82854729..82854920 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035476 (Map3k7ip3) NM_025729 mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene [Source:MGI (curated);Acc:Map3k7ip3-001]

 
Come back to gene ENSMUSG00000035476


For any suggestions or comments, please send an email to unitrap@crg.es