Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST62979
Clone ID OST62979
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST62979
Sequence
GCTCACAACCAAACGAGTGTTCTGGAAGGGTGTTTTGGAGGAAGTTGTTGTGGTTTATCAAGGTCCTAGATGGCACTTGT
TGCACAGATATCCGTGCAGGCAAAAGAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30398172..30398234 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025747 (Tyms) NM_021288 thymidylate synthase Gene [Source:MGI (curated);Acc:Tyms-001]

 
Come back to gene ENSMUSG00000025747


For any suggestions or comments, please send an email to unitrap@crg.es