Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST62925
Clone ID OST62925
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST62925
Sequence
GATCTGTGTGTTATCAGCAAGAGCAAGCTGGACTTTCTTNGTCCATTCTCAGTGCCCAACAAGAAAGGGACCAGGCTTGG
CCGGTACAGATGTNANAAAGGCACTACCGCTGTCCTCACCGAGAAAGTTACCCCTCTGGAGATTGAGGTGCTAGAAGAGA
CTGTTCANACAATGGATACTTCGTGAATGGTGCTGTGGGTGGTTGGATAACTCTAGATGACTCGGGGTGCATACCACCCC
TACCCCAACCCCATTCTACCCCAACCAGAAAACATGCCTTTGGCAATTGCTCAATTAAAATAA
Sequence Type mRNA
Unitrap ID UNI3326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38443580..38446290 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026750 (Psmb7) NM_011187 proteasome (prosome, macropain) subunit, beta type 7 Gene [Source:MGI (curated);Acc:Psmb7-001]

 
Come back to gene ENSMUSG00000026750


For any suggestions or comments, please send an email to unitrap@crg.es