Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST62889
Clone ID OST62889
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST62889
Sequence
ATCTCTGCCCGGAAGCGCTTAAAGGGCGAGAAGACTGACCTGGTGAGCCAGATGCAGCAGCTGTACGCCACGCTGGAGAG
CCGCGAGGAGCAGTTGCGAGACTTCATCCGCAACTATGAGCAGCACCGCAAGGAGAGTGAAGACGCAGTCAAAGCACTGG
CCAAGGAGAAGGACCTGCTGGAGCGAGAGAAGTGGGAGCTTCGACGGCAGGCCAAGGAAGCCACAGACCATGCTGCGGCC
CTGCGCTCCCAGCTGGACCTCAAGGACAACCGCATGAAGGAGCTGGAGGCGGAGCTCGCCATGGTGAGCCCGCACTGNGC
ACTGGCTGTGGAGGATCACCCTGGACACTCAAACCCCTNAGGGAGAAGGAGCTAANGGGANAACAATGGGCTGTGTGACA
CTCCTGATTTGGGGACCTCTGAACCCAAGAACACTGGCTTTCTTGGGAGGCCTCACTTGGCCACATGTCCTACTNCTTCG
AAAATGTGGGGCNATGGGAAGGCNTATTGNGGCCANAATAATCATATTATTTTGGTTAAAAAA
Sequence Type mRNA
Unitrap ID UNI17248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141710101..141715086 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

 
Come back to gene ENSMUSG00000040606


For any suggestions or comments, please send an email to unitrap@crg.es