Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0335
Clone ID BC0335
Vector pGT2lxr
Project sanger

Sequence tag BC0335
Sequence
CTCTTACTGGCCGCCGCAGCGAGGGAAGAGGGTGCGGCCGCCGCGGCGGGGACTGAGGCACAGACTGACCCGGCGTGGAC
CGCGGAGATGCTGGGCGTGGCGGCCGGAATGACCAACAG
Sequence Type mRNA
Unitrap ID UNI921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57786323..57786435 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019920 (Lims1) NM_026148 LIM and senescent cell antigen-like domains 1 Gene [Source:MGI (curated);Acc:Lims1-001]

 
Come back to gene ENSMUSG00000019920


For any suggestions or comments, please send an email to unitrap@crg.es