Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST62569
Clone ID OST62569
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST62569
Sequence
ACACGTACTTATGTTAACTGACCAANATGATCAGTAGAATTGAATATGTGCATACAAAGAATTTTATACACAGAGACATT
AAACCAGATAACTTCCTAATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCAAAAAGTA
CAGAGACAACAGGACAAGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATACGCCAGCATCA
ATGCACATCTTGGTATTGAGCAGAATCGCCGA
Sequence Type mRNA
Unitrap ID UNI23548

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61728023..61735202 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es